Thursday, September 6, 2012

DNA...


Here it goes...

GTTATACACCTTAGACAAATGCAACGCAAGCTTGATCCATTC

Thursday, August 30, 2012

Darwins influence


In my opinion Thomas Malthus had the most influence on Charles Darwin. He followed up on what Darwin would say about animals and humans and the amount of offspring that both could provide. But is it healthy or even possible. In order to survive it would be necessary to think about the well being of either animal or human and what resources are necessary for survival.
Malthus contributed to Darwins theory because both had the same view on Natural Selection. That both humans and/or animals should not produce more offspring than can handle. That we should think about what financial hardships could come our way and if produced more offspring then should rivalry could occur which would end up in survival of the fittest.
Link: http://www.ucmp.berkeley.edu/history/malthus.html
Given the resources, I do not believe Darwin would have developed his natural selection theory. Malthus in my opinion helped Darwin believe in his theory and understand what natural selection is all about on a different level.
The church did not fully agree on what Darwin was all about but they did respect him and his thoughts. Yes, the church did affect him because he knew it would cause some sort of discomfort but it did not stop him from publishing his book and giving his thoughts.